@@ -286,6 +286,7 @@ CACTCGGTCGGCCATATGTTCGGCCATATGTTCGTCTGTTCACTCGCCCATACACT
 - [X] `base2048`: [Base2048](https://github.com/qntm/base2048) custom conversion (11 bits per character, optimised for Twitter)
 - [X] `base32768`: [Base32768](https://github.com/qntm/base32768) custom conversion (15 bits per character, optimised for UTF-16)
 - [X] `base65536`: [Base65536](https://github.com/qntm/base65536) custom conversion (16 bits per character, optimised for UTF-32)
+- [X] `bech32`: [Bech32](https://github.com/bitcoin/bips/blob/master/bip-0173.mediawiki) encoding with a human-readable part ; `bech32m` for its [Bech32m](https://github.com/bitcoin/bips/blob/master/bip-0350.mediawiki) variant
 - [X] `base-genericN`: see [base encodings](https://python-codext.readthedocs.io/en/latest/enc/base.html) ; supports any possible base
 
 This category also contains `ascii85`, `adobe`, `[x]btoa`, `zeromq` with the `base85` codec.
 
@@ -156,6 +156,8 @@ This encoding implements various different versions of Base85.
 `base122` | text <-> Base122 encoded text | `base[-_]?122` | Python 3 only
 `base128` | text <-> Base128 encoded text | `base[-_]?128` | Relies on the ASCII charset
 `base1024` | data <-> Ecoji encoded text | `base[-_]?1024`, `ecoji`, `ecoji-v1`, `ecoji-v2` | 10 bits per emoji ; encodes with Ecoji version 2 by default
+`bech32` | data <-> Bech32 encoded text | `bech32-<hrp>` | human-readable part required for encoding
+`bech32m` | data <-> Bech32m encoded text | `bech32m-<hrp>` | human-readable part required for encoding
 `base2048` | data <-> Base2048 encoded text | `base[-_]?2048` | 11 bits per character, optimised for Twitter
 `base32768` | data <-> Base32768 encoded text | `base[-_]?32768` | 15 bits per character, optimised for UTF-16
 `base65536` | data <-> Base65536 encoded text | `base[-_]?65536` | 16 bits per character, optimised for UTF-32
@@ -197,3 +199,14 @@ Base1024, also known as [Ecoji](https://github.com/keith-turner/ecoji), encodes
 >>> codext.decode("🏯🔩🚗🌷🍌☕☕☕", "base1024")
 'Hello!'
 ```
+
+Bech32 ([BIP-173](https://github.com/bitcoin/bips/blob/master/bip-0173.mediawiki)) and Bech32m ([BIP-350](https://github.com/bitcoin/bips/blob/master/bip-0350.mediawiki)) write the data with a human-readable part (HRP), the separator "`1`", then the data regrouped by 5 bits in the alphabet "`qpzry9x8gf2tvdw0s3jn54khce6mua7l`", followed by a 6-character checksum computed over the HRP and the data. The HRP is required for encoding. When decoding, it is read from the text and only checked if given with the codec name ; the data is returned without it. The length limit of 90 characters of BIP-173 is not enforced. SegWit addresses, whose first data character is the witness version, are not decoded as such.
+
+```python
+>>> codext.encode("Hello, World!", "bech32-test")
+'test1fpjkcmr09ss9wmmjd3jzzw2fmd3'
+>>> codext.decode("test1fpjkcmr09ss9wmmjd3jzzw2fmd3", "bech32")
+'Hello, World!'
+>>> codext.encode("Hello, World!", "bech32m-test")
+'test1fpjkcmr09ss9wmmjd3jzzmkehgn'
+```
@@ -8,6 +8,7 @@
 from .base100 import *
 from .base122 import *
 from .base1024 import *
+from .bech32 import *
 from .base65536 import *
 from .baseN import *
 from ..__common__ import *
 
@@ -0,0 +1,119 @@
+# -*- coding: UTF-8 -*-
+"""Bech32/Bech32m Codecs - bech32 and bech32m content encodings.
+
+Bech32 (BIP-173) and Bech32m (BIP-350) write the data with a human-readable part (HRP), the separator "1", then the
+ data regrouped by 5 bits (the last group being padded with zero bits) in the alphabet
+ "qpzry9x8gf2tvdw0s3jn54khce6mua7l", followed by a 6-character BCH checksum computed over the HRP and the data ; both
+ only differ by the constant of their checksum.
+
+The HRP is required for encoding (e.g. "bech32-bc") ; without it, a ValueError is raised. When decoding, it is read
+ from the text and only checked if given with the codec name ; the data is returned without it. The length limit of 90
+ characters of BIP-173 is not enforced.
+
+NB: this does not decode SegWit addresses, whose first data character is the witness version.
+
+This codec:
+- en/decodes strings from str to str
+- en/decodes strings from bytes to bytes
+- decodes file content to str (read)
+- encodes file content from str to bytes (write)
+
+Reference: https://github.com/bitcoin/bips/blob/master/bip-0173.mediawiki
+           https://github.com/bitcoin/bips/blob/master/bip-0350.mediawiki
+"""
+from ..__common__ import *
+
+
+_DATA = "\x00\x44\x32\x14\xc7\x42\x54\xb6\x35\xcf\x84\x65\x3a\x56\xd7\xc6\x75\xbe\x77\xdf"
+# data whose 5-bit values are 0, 1, ..., 31 (Bech32 test vector) and 31, 30, ..., 0 (Bech32m test vector)
+_DATAM = "\xff\xbb\xcd\xeb\x38\xbd\xab\x49\xca\x30\x7b\x9a\xc5\xa9\x28\x39\x8a\x41\x88\x20"
+__examples1__ = {
+    'enc(bech32)':           {'test': None},
+    'enc(bech32-abcdef)':    {_DATA: "abcdef1qpzry9x8gf2tvdw0s3jn54khce6mua7lmqqqxw", '': "abcdef1hu3qdg"},
+    'dec(bech32)':           {'abcdef1qpzry9x8gf2tvdw0s3jn54khce6mua7lmqqqxw': _DATA, 'A12UEL5L': "", 'a12uel5l': "",
+                              '?1ezyfcl': "", 'split1checkupstagehandshakeupstreamerranterredcaperred2y9e3w':
+                              "\xc5\xf3\x8b\x70\x30\x5f\x51\x9b\xf6\x6d\x85\xfb\x6c\xf0\x30\x58\xf3\xdd\xe4\x63\xec\xd7"
+                              "\x91\x8f\x2d\xc7\x43\x91\x8f\x2d",
+                              "an83characterlonghumanreadablepartthatcontainsthenumber1andtheexcludedcharactersbio"
+                              "1tt5tgs": "", 'pzry9x0s0muk': None, '1pzry9x0s0muk': None, 'x1b4n0q5v': None,
+                              'li1dgmt3': None, 'A1G7SGD8': None, '10a06t8': None, '1qzzfhee': None,
+                              'aBcDef1qpzry9x8gf2tvdw0s3jn54khce6mua7lmqqqxw': None, 'a1lqfn3a': None, 'a1qq': None,
+                              "11" + "q" * 82 + "c8247j": "\x00" * 51},
+    'dec(bech32-abcdef)':    {'abcdef1qpzry9x8gf2tvdw0s3jn54khce6mua7lmqqqxw': _DATA, 'a12uel5l': None},
+    'enc-dec(bech32-a|bech32_bc|bech32-cosmos)': ["", "Hello, World!", "@random{512,1024}"],
+}
+__examples2__ = {
+    'enc(bech32m)':          {'test': None},
+    'enc(bech32m-abcdef)':   {_DATAM: "abcdef1l7aum6echk45nj3s0wdvt2fg8x9yrzpqzd3ryx"},
+    'dec(bech32m)':          {'abcdef1l7aum6echk45nj3s0wdvt2fg8x9yrzpqzd3ryx': _DATAM, 'a1lqfn3a': "",
+                              'A1LQFN3A': "", '?1v759aa': "", 'a12uel5l': None, 'M1VUXWEZ': None, 'abc1rzg': None,
+                              # valid Bech32m string, but its padding bits ("11") are not zero, hence no valid bytes
+                              "11" + "l" * 82 + "ludsr8": None},
+    'enc-dec(bech32m-a|bech32m_bc|bech32m-cosmos)': ["", "Hello, World!", "@random{512,1024}"],
+}
+__guess1__, __guess2__ = ["bech32"], ["bech32m"]
+
+
+CHARSET, CONSTANTS = "qpzry9x8gf2tvdw0s3jn54khce6mua7l", {'bech32': 1, 'bech32m': 0x2bc830a3}
+
+
+def __polymod(values):
+    """ BCH checksum computation, as defined in BIP-173. """
+    chk = 1
+    for v in values:
+        b = chk >> 25
+        chk = (chk & 0x1ffffff) << 5 ^ v
+        for i, g in enumerate((0x3b6a57b2, 0x26508e6d, 0x1ea119fa, 0x3d4233dd, 0x2a1462b3)):
+            chk ^= g if b >> i & 1 else 0
+    return chk
+
+
+def __hrp_expand(hrp):
+    return [ord(c) >> 5 for c in hrp] + [0] + [ord(c) & 31 for c in hrp]
+
+
+def __bech32(name, decode=False):
+    def _wrapper(hrp=None):
+        # an HRP made of digits is given as an integer by the codec name pattern
+        hrp = str(hrp or "")
+        # a missing HRP is only reported when encoding, as the bare codec name is used for decoding (e.g. when guessing)
+        def _code(text, errors="strict"):
+            _h, text = handle_error(name, errors, decode=decode, kind="token"), ensure_str(text)
+            if not decode:
+                if not hrp:
+                    raise ValueError(f"Bad parameter for encoding '{name}': a human-readable part is required")
+                bits = "".join(f"{x:08b}" for x in b(text))
+                bits += "0" * (-len(bits) % 5)
+                values = [int(bits[i:i+5], 2) for i in range(0, len(bits), 5)]
+                chk = __polymod(__hrp_expand(hrp) + values + [0] * 6) ^ CONSTANTS[name]
+                values += [chk >> 5 * (5 - i) & 31 for i in range(6)]
+                return (s := hrp + "1" + "".join(CHARSET[v] for v in values)), len(s)
+            # strict mode: mixed case, missing separator or HRP, too short checksum, wrong characters or checksum,
+            #  wrong HRP and non-zero padding are errors ; otherwise, the data is decoded as far as possible
+            if text.lower() != text and text.upper() != text:
+                _h(text, 0)
+            text = text.lower()
+            if (pos := text.rfind("1")) < 1 or pos + 7 > len(text) or any(not 33 <= ord(c) <= 126 for c in text[:pos]):
+                return (r := b(_h(text, 0))), len(r)
+            h, values = text[:pos], []
+            if hrp and h != hrp:
+                _h(h, 0)
+            for i, c in enumerate(text[pos+1:], pos + 1):
+                if c in CHARSET:
+                    values.append(CHARSET.index(c))
+                else:
+                    _h(c, i)
+            if __polymod(__hrp_expand(h) + values) != CONSTANTS[name]:
+                _h(text[-6:], len(text) - 6)
+            bits = "".join(f"{v:05b}" for v in values[:-6])
+            if len(bits) % 8 >= 5 or "1" in bits[len(bits) - len(bits) % 8:]:
+                _h(text[-7], len(text) - 7)
+            r = bytes(int(bits[i:i+8], 2) for i in range(0, len(bits) - 7, 8))
+            return r, len(r)
+        return _code
+    return _wrapper
+
+
+for _n, _ex, _gs in [("bech32", __examples1__, __guess1__), ("bech32m", __examples2__, __guess2__)]:
+    add(_n, __bech32(_n), __bech32(_n, True), rf"^{_n}(?:[-_]([a-z0-9]+))?$", examples=_ex, guess=_gs,
+        printables_rate=1., expansion_factor=1.6)